CRISPR

CRISPR1-npas4l

ID
ZDB-CRISPR-160822-2
Name
CRISPR1-npas4l
Previous Names
  • CRISPR1-clo (1)
Target
Sequence
5' - TCTGGATGGCGCTGTGCCGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
bns59 npas4l
Expression
Gene expression in Wild Types + CRISPR1-npas4l
No data available
Phenotype
Phenotype resulting from CRISPR1-npas4l
No data available
Phenotype of all Fish created by or utilizing CRISPR1-npas4l
Phenotype Fish Conditions Figures
posterior lateral plate mesoderm etsrp expression decreased distribution, abnormal npas4lbns59/bns59 standard conditions Fig. 2 from Reischauer et al., 2016
posterior lateral plate mesoderm tal1 expression decreased amount, abnormal npas4lbns59/bns59 standard conditions Fig. 2 from Reischauer et al., 2016
intermediate cell mass of mesoderm gata1a expression decreased distribution, abnormal npas4lbns59/bns59 standard conditions Fig. S4 from Reischauer et al., 2016
cardiovascular system kdrl expression decreased amount, abnormal npas4lbns59/bns59 standard conditions Fig. S4 from Reischauer et al., 2016
intermediate cell mass of mesoderm decreased size, abnormal npas4lbns59/bns59 standard conditions Fig. 2,  Fig. S4 from Reischauer et al., 2016
intermediate cell mass of mesoderm tal1 expression decreased amount, abnormal npas4lbns59/bns59 standard conditions Fig. S4 from Reischauer et al., 2016
posterior lateral plate mesoderm etsrp expression decreased amount, abnormal npas4lbns59/bns59 standard conditions Fig. 2 from Reischauer et al., 2016
posterior lateral plate mesoderm tal1 expression decreased distribution, abnormal npas4lbns59/bns59 standard conditions Fig. 2 from Reischauer et al., 2016
intermediate cell mass of mesoderm hbae3 expression decreased amount, abnormal npas4lbns59/bns59 standard conditions Fig. S4 from Reischauer et al., 2016
posterior lateral mesoderm tal1 expression decreased amount, abnormal npas4lbns59/bns59 standard conditions Fig. 2 from Reischauer et al., 2016
intermediate cell mass of mesoderm gata1a expression decreased amount, abnormal npas4lbns59/bns59 standard conditions Fig. S4 from Reischauer et al., 2016
intermediate cell mass of mesoderm tal1 expression decreased distribution, abnormal npas4lbns59/bns59 standard conditions Fig. S4 from Reischauer et al., 2016
intermediate cell mass of mesoderm etsrp expression decreased distribution, abnormal npas4lbns59/bns59 standard conditions Fig. S4 from Reischauer et al., 2016
intermediate cell mass of mesoderm hbae3 expression decreased distribution, abnormal npas4lbns59/bns59 standard conditions Fig. S4 from Reischauer et al., 2016
intermediate cell mass of mesoderm etsrp expression decreased amount, abnormal npas4lbns59/bns59 standard conditions Fig. S4 from Reischauer et al., 2016
lateral plate mesoderm decreased size, abnormal npas4lbns59/bns59 standard conditions Fig. 2 from Reischauer et al., 2016
posterior lateral mesoderm etsrp expression decreased amount, abnormal npas4lbns59/bns59 standard conditions Fig. 2 from Reischauer et al., 2016
cardiovascular system kdrl expression decreased distribution, abnormal npas4lbns59/bns59 standard conditions Fig. S4 from Reischauer et al., 2016
blood vasculature lacks parts or has fewer parts of type blood vessel, abnormal npas4lbns59/bns59; s843Tg standard conditions Fig. 2 from Reischauer et al., 2016
caudal vein plexus EGFP expression decreased amount, abnormal npas4lbns59/bns59; s843Tg standard conditions Fig. 2 from Reischauer et al., 2016
intersegmental vessel EGFP expression decreased amount, abnormal npas4lbns59/bns59; s843Tg standard conditions Fig. 2 from Reischauer et al., 2016
heart EGFP expression spatial pattern, abnormal npas4lbns59/bns59; s843Tg standard conditions Fig. S4 from Reischauer et al., 2016
blood vasculature lacks parts or has fewer parts of type blood vessel, abnormal npas4ls5/+; npas4lbns59/+; s843Tg standard conditions Fig. 2 from Reischauer et al., 2016
caudal vein plexus EGFP expression decreased amount, abnormal npas4ls5/+; npas4lbns59/+; s843Tg standard conditions Fig. 2 from Reischauer et al., 2016
intersegmental vessel EGFP expression decreased amount, abnormal npas4ls5/+; npas4lbns59/+; s843Tg standard conditions Fig. 2 from Reischauer et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.