CRISPR

CRISPR1-becn1

ID
ZDB-CRISPR-160729-2
Name
CRISPR1-becn1
Previous Names
  • Z001402 (1)
Target
Sequence
5' - GGAGAACAAACAAGATGGCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hza56 becn1
Expression
Gene expression in Wild Types + CRISPR1-becn1
No data available
Phenotype
Phenotype resulting from CRISPR1-becn1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-becn1
Phenotype Fish Conditions Figures
whole organism dead, abnormal becn1hza56/hza56 (AB) standard conditions text only from Mawed et al., 2020
male organism liver ab13-tp53 labeling increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 6 with image from Mawed et al., 2020
male organism liver jak3 expression increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 6 with image from Mawed et al., 2020
male organism liver inflamed, abnormal becn1hza56/+ (AB) standard conditions Figure 7 with image from Mawed et al., 2020
male organism liver ab4-map1lc3 labeling decreased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 5 with image from Mawed et al., 2020
male organism curved, abnormal becn1hza56/+ (AB) standard conditions Figure 2 with image from Mawed et al., 2020
male organism liver tp53 expression increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 6 with image from Mawed et al., 2020
male organism focus of cellular alteration increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 2 with image from Mawed et al., 2020
male organism liver hk1 expression increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 4 with image from Mawed et al., 2020
male organism pleuroperitoneal cavity distended, abnormal becn1hza56/+ (AB) standard conditions Figure 2 with image from Mawed et al., 2020
male organism decreased life span, abnormal becn1hza56/+ (AB) standard conditions Figure 2 with image from Mawed et al., 2020
male organism liver increased size, abnormal becn1hza56/+ (AB) standard conditions Figure 2 with image from Mawed et al., 2020
male organism liver akt1s1 expression increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 5 with image from Mawed et al., 2020
male organism liver siva1 expression decreased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 6 with image from Mawed et al., 2020
male organism liver cpt1aa expression decreased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 4 with image from Mawed et al., 2020
male organism liver stat3 expression increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 6 with image from Mawed et al., 2020
male organism liver il1b expression increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 6 with image from Mawed et al., 2020
male organism viability, abnormal becn1hza56/+ (AB) standard conditions Figure 2 with image from Mawed et al., 2020
male organism liver Ab6-atg5 labeling decreased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 5 with image from Mawed et al., 2020
male organism increased accumulation liver lipid, abnormal becn1hza56/+ (AB) standard conditions Figure 3 with image from Mawed et al., 2020
male organism liver acaca expression increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 4 with image from Mawed et al., 2020
male organism liver fibrotic, abnormal becn1hza56/+ (AB) standard conditions Figure 3 with image from Mawed et al., 2020
male organism liver Ab2-il6 labeling increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 6 with image,  Figure 7 with image from Mawed et al., 2020
male organism decreased accumulation liver glycogen, abnormal becn1hza56/+ (AB) standard conditions Figure 3 with image from Mawed et al., 2020
hepatocyte apoptotic chromosome condensation increased occurrence, abnormal becn1hza56/+ (AB) standard conditions Figure 2 with image from Mawed et al., 2020
male organism hepatic tumor present, abnormal becn1hza56/+ (AB) standard conditions Figure 2 with image from Mawed et al., 2020
male organism liver ab5-akt labeling increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 5 with image from Mawed et al., 2020
male organism liver mcl1a expression increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 5 with image from Mawed et al., 2020
male organism liver pik3ca expression increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 5 with image from Mawed et al., 2020
male organism liver atg7 expression increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 5 with image from Mawed et al., 2020
male organism liver caspa expression decreased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 6 with image from Mawed et al., 2020
liver apoptotic process decreased occurrence, abnormal becn1hza56/+ (AB) standard conditions Figure 7 with image from Mawed et al., 2020
male organism liver bcl2a expression increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 5 with image from Mawed et al., 2020
male organism liver pck1 expression decreased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 4 with image from Mawed et al., 2020
male organism liver gck expression increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 4 with image from Mawed et al., 2020
male organism liver pik3r1 expression increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 5 with image from Mawed et al., 2020
male organism liver necrotic, abnormal becn1hza56/+ (AB) standard conditions Figure 2 with image,  Figure 7 with image from Mawed et al., 2020
male organism hepatocyte proliferation increased occurrence, abnormal becn1hza56/+ (AB) standard conditions Figure 7 with image from Mawed et al., 2020
male organism liver pklr expression increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 4 with image from Mawed et al., 2020
male organism liver cd36 expression increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 4 with image from Mawed et al., 2020
male organism liver fasn expression increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 4 with image from Mawed et al., 2020
male organism liver sqstm1 expression increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 5 with image from Mawed et al., 2020
male organism liver srebf1 expression increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 4 with image from Mawed et al., 2020
male organism liver ab4-sqstm1 labeling increased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 5 with image from Mawed et al., 2020
male organism liver gys1 expression decreased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 4 with image from Mawed et al., 2020
male organism liver baxa expression decreased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 6 with image from Mawed et al., 2020
male organism liver g6pc1a.1 expression decreased amount, abnormal becn1hza56/+ (AB) standard conditions Figure 4 with image from Mawed et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.