CRISPR

CRISPR1-slc18a2

ID
ZDB-CRISPR-160415-1
Name
CRISPR1-slc18a2
Previous Names
None
Target
Sequence
5' - GGACGACGAGGCTGCTCAGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
sus100 slc18a2
sus101 slc18a2
zf3752 slc18a2
Expression
Gene expression in Wild Types + CRISPR1-slc18a2
No data available
Phenotype
Phenotype resulting from CRISPR1-slc18a2
No data available
Phenotype of all Fish created by or utilizing CRISPR1-slc18a2
Phenotype Fish Conditions Figures
heart heart contraction increased rate of continuous process, abnormal slc18a2zf3752/zf3752 standard conditions Fig. 1 with image from Baronio et al., 2021
brain ab1-serotonin labeling decreased distribution, abnormal slc18a2zf3752/zf3752 standard conditions Fig. 6 with image from Baronio et al., 2021
whole organism serotonin decreased amount, abnormal slc18a2zf3752/zf3752 standard conditions Fig. 6 with image from Baronio et al., 2021
brain hdc expression increased distribution, abnormal slc18a2zf3752/zf3752 standard conditions Fig. 3 with image from Baronio et al., 2021
whole organism histamine decreased amount, abnormal slc18a2zf3752/zf3752 standard conditions Fig. 3 with image from Baronio et al., 2021
whole organism slc18a2 expression decreased amount, abnormal slc18a2zf3752/zf3752 standard conditions Fig. 1 with image from Baronio et al., 2021
hindbrain pax2a expression decreased distribution, abnormal slc18a2zf3752/zf3752 standard conditions Fig. 7 with image from Baronio et al., 2021
hypothalamus posterior region th2 expression increased distribution, abnormal slc18a2zf3752/zf3752 standard conditions Fig. 4 with image from Baronio et al., 2021
whole organism th2 expression increased amount, abnormal slc18a2zf3752/zf3752 standard conditions Fig. 4 with image from Baronio et al., 2021
startle response increased process quality, abnormal slc18a2zf3752/zf3752 altered light dark cycle Fig. 2 with image from Baronio et al., 2021
midbrain pax2a expression decreased distribution, abnormal slc18a2zf3752/zf3752 standard conditions Fig. 7 with image from Baronio et al., 2021
swimming behavior decreased process quality, abnormal slc18a2zf3752/zf3752 altered light dark cycle Fig. 2 with image from Baronio et al., 2021
brain slc18a2 expression decreased distribution, abnormal slc18a2zf3752/zf3752 standard conditions Fig. 1 with image from Baronio et al., 2021
whole organism manf expression increased amount, abnormal slc18a2zf3752/zf3752 standard conditions Fig. 7 with image from Baronio et al., 2021
whole organism (5-hydroxyindol-3-yl)acetic acid increased amount, abnormal slc18a2zf3752/zf3752 standard conditions Fig. 6 with image from Baronio et al., 2021
whole organism th expression increased amount, abnormal slc18a2zf3752/zf3752 standard conditions Fig. 4 with image from Baronio et al., 2021
whole organism notch1a expression decreased amount, abnormal slc18a2zf3752/zf3752 standard conditions Fig. 7 with image from Baronio et al., 2021
hypothalamus ab1-histamine labeling decreased distribution, abnormal slc18a2zf3752/zf3752 standard conditions Fig. 3 with image from Baronio et al., 2021
brain notch1a expression decreased distribution, abnormal slc18a2zf3752/zf3752 standard conditions Fig. 7 with image from Baronio et al., 2021
hypothalamus tph1a expression increased distribution, abnormal slc18a2zf3752/zf3752 standard conditions Fig. 6 with image from Baronio et al., 2021
brain serotonin decreased amount, abnormal slc18a2sus100/+ standard conditions Fig. 4 from Wang et al., 2016
brain (5-hydroxyindol-3-yl)acetic acid increased amount, abnormal slc18a2sus100/+ standard conditions Fig. 4 from Wang et al., 2016
brain noradrenaline decreased amount, abnormal slc18a2sus100/+ standard conditions Fig. 4 from Wang et al., 2016
brain dopamine decreased amount, abnormal slc18a2sus100/+ standard conditions Fig. 4 from Wang et al., 2016
locomotory exploration behavior process quality, abnormal slc18a2sus100/+ standard conditions Fig. 3 from Wang et al., 2016
swimming behavior process quality, abnormal slc18a2sus100/+ standard conditions Fig. 2 from Wang et al., 2016
locomotory exploration behavior process quality, abnormal slc18a2sus101/+ standard conditions Fig. 3 from Wang et al., 2016
swimming behavior process quality, abnormal slc18a2sus101/+ standard conditions Fig. 2 from Wang et al., 2016
Citations