CRISPR

CRISPR2-tph1a

ID
ZDB-CRISPR-160128-324
Name
CRISPR2-tph1a
Previous Names
  • Z000426 (1)
Target
Sequence
5' - GGGAAAACACAACCGCAGCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3' end.
Genome Resources
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ot203 tph1a
ot204 tph1a
Expression
Gene expression in Wild Types + CRISPR2-tph1a
No data available
Phenotype
Phenotype resulting from CRISPR2-tph1a
No data available
Phenotype of all Fish created by or utilizing CRISPR2-tph1a
Phenotype Fish Conditions Figures
whole organism tph1a expression decreased amount, abnormal tph1aot203/ot203 standard conditions Fig. 3 from Pan et al., 2020
trunk serotonin decreased amount, abnormal tph1aot203/ot203 standard conditions Fig. 4 from Pan et al., 2020
integument neuroepithelial cell ab1-serotonin labeling decreased distribution, abnormal tph1aot203/ot203 standard conditions Fig. 5 from Pan et al., 2020
response to hypoxia process quality, abnormal tph1aot203/ot203 hypoxia Fig. 7 from Pan et al., 2020
whole organism tph1a expression decreased amount, abnormal tph1aot204/ot204 standard conditions Fig. 3 from Pan et al., 2020
integument neuroepithelial cell ab1-serotonin labeling decreased distribution, abnormal tph1aot204/ot204 standard conditions Fig. 5 from Pan et al., 2020
response to hypoxia process quality, abnormal tph1aot204/ot204 hypoxia Fig. 7 from Pan et al., 2020
trunk serotonin decreased amount, abnormal tph1aot204/ot204 standard conditions Fig. 4 from Pan et al., 2020
integument neuroepithelial cell ab1-serotonin labeling decreased distribution, abnormal tph1aot203/ot203 + MO2-tph1b control Fig. 6 from Pan et al., 2020
integument neuroepithelial cell ab1-serotonin labeling decreased distribution, abnormal tph1aot204/ot204 + MO2-tph1b control Fig. 6 from Pan et al., 2020
whole organism tph1b expression increased amount, abnormal tph1aot203/ot203; tph1bf234jy/f234jy standard conditions Fig. 3 from Pan et al., 2020
integument neuroepithelial cell ab1-serotonin labeling decreased distribution, abnormal tph1aot203/ot203; tph1bf234jy/f234jy standard conditions Fig. 5 from Pan et al., 2020
whole organism tph1a expression decreased amount, abnormal tph1aot203/ot203; tph1bf234jy/f234jy standard conditions Fig. 3 from Pan et al., 2020
trunk serotonin decreased amount, abnormal tph1aot203/ot203; tph1bf234jy/f234jy standard conditions Fig. 4 from Pan et al., 2020
response to hypoxia process quality, abnormal tph1aot203/ot203; tph1bf234jy/f234jy hypoxia Fig. 7 from Pan et al., 2020
whole organism tph1b expression increased amount, abnormal tph1aot204/ot204; tph1bf234jy/f234jy standard conditions Fig. 3 from Pan et al., 2020
integument neuroepithelial cell ab1-serotonin labeling decreased distribution, abnormal tph1aot204/ot204; tph1bf234jy/f234jy standard conditions Fig. 5 from Pan et al., 2020
response to hypoxia process quality, abnormal tph1aot204/ot204; tph1bf234jy/f234jy hypoxia Fig. 7 from Pan et al., 2020
whole organism tph1a expression decreased amount, abnormal tph1aot204/ot204; tph1bf234jy/f234jy standard conditions Fig. 3 from Pan et al., 2020
trunk serotonin decreased amount, abnormal tph1aot204/ot204; tph1bf234jy/f234jy standard conditions Fig. 4 from Pan et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.