CRISPR

CRISPR1-nod1

ID

ZDB-CRISPR-150427-1

Name

CRISPR1-nod1

Previous Names

None

Target

nod1 (1)

Sequence

5' - GGCTGAGACTATCTTCATCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

located at exon 3 of nod1 gene

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ihb44	nod1
ihb52	nod1

Expression

Gene expression in Wild Types + CRISPR1-nod1

No data available

Phenotype

Phenotype resulting from CRISPR1-nod1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-nod1

Phenotype	Fish	Conditions	Figures
whole organism ifnphi3 expression decreased amount, abnormal	nod1^ihb52/ihb52	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 1 from Wu et al., 2020
whole organism irf3 expression amount, ameliorated	nod1^ihb52/ihb52	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 1 from Wu et al., 2020
whole organism pkz expression amount, ameliorated	nod1^ihb52/ihb52	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 1 from Wu et al., 2020
whole organism mxa expression amount, ameliorated	nod1^ihb52/ihb52	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 1 from Wu et al., 2020
whole organism ifih1 expression decreased amount, abnormal	nod1^ihb52/ihb52	standard conditions	Fig. 1 from Wu et al., 2020
whole organism mxe expression decreased amount, abnormal	nod1^ihb52/ihb52	standard conditions	Fig. 1 from Wu et al., 2020
whole organism il1b expression decreased amount, abnormal	nod1^ihb52/ihb52	standard conditions	Fig. 1 from Wu et al., 2020
whole organism mxe expression amount, ameliorated	nod1^ihb52/ihb52	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 1 from Wu et al., 2020
whole organism irf3 expression decreased amount, abnormal	nod1^ihb52/ihb52	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 1 from Wu et al., 2020
whole organism viability, abnormal	nod1^ihb52/ihb52	standard conditions	Fig. 2 from Hu et al., 2017
hatching behavior decreased rate, abnormal	nod1^ihb52/ihb52	standard conditions	Fig. 2 from Hu et al., 2017
whole organism mxb expression decreased amount, abnormal	nod1^ihb52/ihb52	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 1 from Wu et al., 2020
whole organism cd44a expression decreased amount, abnormal	nod1^ihb52/ihb52	standard conditions	Fig. 3 from Cao et al., 2019
whole organism mxb expression amount, ameliorated	nod1^ihb52/ihb52	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 1 from Wu et al., 2020
whole organism mavs expression decreased amount, abnormal	nod1^ihb52/ihb52	standard conditions	Fig. 1 from Wu et al., 2020
whole organism mxa expression decreased amount, abnormal	nod1^ihb52/ihb52	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 1 from Wu et al., 2020
whole organism mxc expression decreased amount, abnormal	nod1^ihb52/ihb52	standard conditions	Fig. 1 from Wu et al., 2020
whole organism mxc expression amount, ameliorated	nod1^ihb52/ihb52	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 1 from Wu et al., 2020
whole organism pkz expression decreased amount, abnormal	nod1^ihb52/ihb52	standard conditions	Fig. 1 from Wu et al., 2020
whole organism ifnphi3 expression amount, ameliorated	nod1^ihb52/ihb52	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 1 from Wu et al., 2020
whole organism il1b expression decreased amount, abnormal	nod1^ihb52/ihb52	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 1 from Wu et al., 2020
whole organism pkz expression decreased amount, abnormal	nod1^ihb52/ihb52	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 1 from Wu et al., 2020
whole organism irf3 expression increased amount, abnormal	nod1^ihb52/ihb52	standard conditions	Fig. 1 from Wu et al., 2020
whole organism mavs expression amount, ameliorated	nod1^ihb52/ihb52	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 1 from Wu et al., 2020
whole organism ifih1 expression decreased amount, abnormal	nod1^ihb52/ihb52	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 1 from Wu et al., 2020
whole organism mxa expression decreased amount, abnormal	nod1^ihb52/ihb52	standard conditions	Fig. 1 from Wu et al., 2020
whole organism ifih1 expression amount, ameliorated	nod1^ihb52/ihb52	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 1 from Wu et al., 2020
whole organism mxe expression decreased amount, abnormal	nod1^ihb52/ihb52	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 1 from Wu et al., 2020
whole organism irf3 expression decreased amount, abnormal	nod1^ihb52/ihb52	standard conditions	Fig. 1 from Wu et al., 2020
whole organism Ab6-mapk14 labeling decreased amount, abnormal	nod1^ihb52/ihb52 (AB/TU)	standard conditions	Fig. 6 from Wu et al., 2018
whole organism ab13-mapk labeling decreased amount, abnormal	nod1^ihb52/ihb52 (AB/TU)	standard conditions	Fig. 6 from Wu et al., 2018
whole organism ab4-atg5 labeling decreased amount, abnormal	nod1^ihb52/ihb52 (AB/TU)	standard conditions	Fig. 6 from Wu et al., 2018
whole organism Ab9-sqstm1 labeling decreased amount, abnormal	nod1^ihb52/ihb52 (AB/TU)	standard conditions	Fig. 6 from Wu et al., 2018
whole organism ab7-mapk labeling decreased amount, abnormal	nod1^ihb52/ihb52 (AB/TU)	standard conditions	Fig. 6 from Wu et al., 2018
whole organism ab2-map1lc3b labeling decreased amount, abnormal	nod1^ihb52/ihb52 (AB/TU)	standard conditions	Fig. 6 from Wu et al., 2018

Citations