CRISPR

CRISPR1-ripk2

ID
ZDB-CRISPR-150424-1
Name
CRISPR1-ripk2
Previous Names
None
Target
Sequence
5' - GGACCTGCACTACATCAGCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ihb45 ripk2
ihb46 ripk2
ihb47 ripk2
Expression
Gene expression in Wild Types + CRISPR1-ripk2
No data available
Phenotype
Phenotype resulting from CRISPR1-ripk2
No data available
Phenotype of all Fish created by or utilizing CRISPR1-ripk2
Phenotype Fish Conditions Figures
whole organism cd44a expression decreased amount, abnormal ripk2ihb47/ihb47 standard conditions Fig. 3 from Cao et al., 2019
whole organism defbl2 expression increased amount, abnormal ripk2ihb47/ihb47 control Fig. 7 from Wu et al., 2019
whole organism hist1h2a3 expression decreased amount, abnormal ripk2ihb47/ihb47 control Fig. 4 from Wu et al., 2019
whole organism rnasel2 expression decreased amount, abnormal ripk2ihb47/ihb47 control Fig. 7 from Wu et al., 2019
whole organism hist1h2a3 expression decreased amount, abnormal ripk2ihb47/ihb47 bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 4 from Wu et al., 2019
whole organism si:dkey-261m9.19 expression decreased amount, abnormal ripk2ihb47/ihb47 control Fig. 4 from Wu et al., 2019
whole organism si:dkey-261m9.19 expression decreased amount, abnormal ripk2ihb47/ihb47 bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 4 from Wu et al., 2019
whole organism pglyrp5 expression decreased amount, abnormal ripk2ihb47/ihb47 control Fig. 7 from Wu et al., 2019
whole organism mhc1zka expression decreased amount, abnormal ripk2ihb47/ihb47 (AB/TU) bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 8 from Wu et al., 2018
whole organism hsp70.3 expression decreased amount, abnormal ripk2ihb47/ihb47 (AB/TU) standard conditions Fig. 4 from Wu et al., 2018
whole organism si:dkey-159n16.2 expression decreased amount, abnormal ripk2ihb47/ihb47 (AB/TU) standard conditions Fig. 5 from Wu et al., 2018
whole organism si:ch211-256e16.11 expression decreased amount, abnormal ripk2ihb47/ihb47 (AB/TU) standard conditions Fig. 5 from Wu et al., 2018
whole organism mhc2daa expression increased amount, abnormal ripk2ihb47/ihb47 (AB/TU) bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 8 from Wu et al., 2018
whole organism si:dkey-190j3.2 expression increased amount, abnormal ripk2ihb47/ihb47 (AB/TU) standard conditions Fig. 5 from Wu et al., 2018
whole organism mhc1zka expression decreased amount, abnormal ripk2ihb47/ihb47 (AB/TU) standard conditions Fig. 4 from Wu et al., 2018
whole organism tapbp.2 expression increased amount, abnormal ripk2ihb47/ihb47 (AB/TU) bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 8 from Wu et al., 2018
whole organism ctss2.2 expression increased amount, abnormal ripk2ihb47/ihb47 (AB/TU) bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 8 from Wu et al., 2018
whole organism si:ch211-214b16.4 expression decreased amount, abnormal ripk2ihb47/ihb47 (AB/TU) standard conditions Fig. 5 from Wu et al., 2018
whole organism ab2-map1lc3b labeling decreased amount, abnormal ripk2ihb47/ihb47 (AB/TU) standard conditions Fig. 6 from Wu et al., 2018
whole organism zmp:0000001020 expression increased amount, abnormal ripk2ihb47/ihb47 (AB/TU) bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 8 from Wu et al., 2018
whole organism cd74a expression increased amount, abnormal ripk2ihb47/ihb47 (AB/TU) bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 8 from Wu et al., 2018
whole organism zmp:0000001020 expression decreased amount, abnormal ripk2ihb47/ihb47 (AB/TU) standard conditions Fig. 5 from Wu et al., 2018
whole organism ctss2.2 expression decreased amount, abnormal ripk2ihb47/ihb47 (AB/TU) standard conditions Fig. 4 from Wu et al., 2018
whole organism mhc2dab expression increased amount, abnormal ripk2ihb47/ihb47 (AB/TU) bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 8 from Wu et al., 2018
whole organism mhc2bl expression increased amount, abnormal ripk2ihb47/ihb47 (AB/TU) bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 8 from Wu et al., 2018
whole organism viability, exacerbated ripk2ihb47/ihb47 (AB/TU) bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 8 from Wu et al., 2018
whole organism b2m expression increased amount, abnormal ripk2ihb47/ihb47 (AB/TU) bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 8 from Wu et al., 2018
whole organism nlrc11 expression decreased amount, abnormal ripk2ihb47/ihb47 (AB/TU) bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 8 from Wu et al., 2018
whole organism si:ch211-256e16.11 expression increased amount, abnormal ripk2ihb47/ihb47 (AB/TU) bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 8 from Wu et al., 2018
hatching delayed, abnormal ripk2ihb47/ihb47 (AB/TU) standard conditions Fig. 1 with image from Wu et al., 2018
whole organism si:ch211-149a19.3 expression increased amount, abnormal ripk2ihb47/ihb47 (AB/TU) bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 8 from Wu et al., 2018
whole organism si:dkey-156k2.1 expression increased amount, abnormal ripk2ihb47/ihb47 (AB/TU) bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 8 from Wu et al., 2018
whole organism psme2 expression increased amount, abnormal ripk2ihb47/ihb47 (AB/TU) bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 8 from Wu et al., 2018
whole organism hsp70.3 expression increased amount, abnormal ripk2ihb47/ihb47 (AB/TU) bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 8 from Wu et al., 2018
whole organism mhc2dab expression decreased amount, abnormal ripk2ihb47/ihb47 (AB/TU) standard conditions Fig. 4 from Wu et al., 2018
whole organism si:dkey-159n16.2 expression increased amount, abnormal ripk2ihb47/ihb47 (AB/TU) bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 8 from Wu et al., 2018
whole organism si:ch211-214b16.4 expression increased amount, abnormal ripk2ihb47/ihb47 (AB/TU) bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 8 from Wu et al., 2018
whole organism mhc2daa expression decreased amount, abnormal ripk2ihb47/ihb47 (AB/TU) standard conditions Fig. 4 from Wu et al., 2018
whole organism dhrs13b.2 expression decreased amount, abnormal ripk2ihb47/ihb47 (AB/TU) standard conditions Fig. 4 from Wu et al., 2018
whole organism psme2 expression decreased amount, abnormal ripk2ihb47/ihb47 (AB/TU) standard conditions Fig. 4 from Wu et al., 2018
whole organism cd44a expression decreased amount, abnormal ripk2ihb47/ihb47 (AB/TU) standard conditions Fig. 7 from Wu et al., 2018
whole organism viability, abnormal ripk2ihb47/ihb47 (AB/TU) standard conditions Fig. 1 with image from Wu et al., 2018
whole organism nlrc11 expression decreased amount, abnormal ripk2ihb47/ihb47 (AB/TU) standard conditions Fig. 5 from Wu et al., 2018
whole organism si:dkey-121n8.7 expression increased amount, abnormal ripk2ihb47/ihb47 (AB/TU) standard conditions Fig. 5 from Wu et al., 2018
whole organism cd74a expression decreased amount, abnormal ripk2ihb47/ihb47 (AB/TU) standard conditions Fig. 4 from Wu et al., 2018
whole organism dhrs13b.2 expression increased amount, abnormal ripk2ihb47/ihb47 (AB/TU) bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 8 from Wu et al., 2018
whole organism mhc2bl expression decreased amount, abnormal ripk2ihb47/ihb47 (AB/TU) standard conditions Fig. 4 from Wu et al., 2018
whole organism si:dkey-29p23.1 expression increased amount, abnormal ripk2ihb47/ihb47 (AB/TU) standard conditions Fig. 5 from Wu et al., 2018
whole organism b2m expression decreased amount, abnormal ripk2ihb47/ihb47 (AB/TU) standard conditions Fig. 4 from Wu et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.