Morpholino Name: | MO1-unc119c | ||||||
---|---|---|---|---|---|---|---|
Target: | unc119c (1) | ||||||
Previous Names: | MO1-unc119.2, unc119c ATG MO (1) | ||||||
Add new Alias
Delete Alias:(Including Attributions) |
|||||||
Sequence: |
5' - GCTCCTTCACACCTTCACTATCCAT - 3'
|
||||||
(Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.) | |||||||
Note: | Translation-blocking morpholino. Note that there is a single-nucleotide difference between the MO sequence in Toyama et al. (2013) and an alternative based on the sequence currently in Ensembl. Alternative version: 5'-GCTCCTTCACACCTTCACCATCCAT . This may be due to a polymorphism. The authors have verified that the published sequence was the one used in their experiments |