CRISPR Name:	CRISPR2-lnc.cnib1
Target:	lnc.cnib1 (1)
Source:
Target Sequence:	5' - CTGCTAGCGAGGACACACTG - 3'
	(Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note:	WARNING: Wang et al. (2019) produced functional evidence that this lncRNA exists and may be conserved The CRISPR and primers sequences to BLAST to the indicated intronic region in pbx3b, however, there is no evidence that any lncRNAs are in this genomic region.