CRISPR Name:	CRISPR1-srsf5b
Target:	srsf5b (1)
Source:
Target Sequence:	5' - GGTCCTTCTCCCGCGCAGAG - 3'
	(Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note:	The first nucleotide was changed from a C to a G in order to make it more suitable for in vitro transcription by T7 polymerase.