CRISPR Name:	CRISPR1-ckap2l
Target:	ckap2l (1)
Source:
Target Sequence:	5' - GGAAGAGGCAGAGACCACAG - 3'
	(Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note:	There is a single base pair mismatch at the 5' end of the CRISPR this is intended to increase sgRNA stability and activity.