Morpholino

MO3-poc1b

ID
ZDB-MRPHLNO-151216-1
Name
MO3-poc1b
Previous Names
  • MO-TB (1)
Target
Sequence
5' - TCCTCCATTACAGACGCCATGATTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-poc1b
No data available
Phenotype
Phenotype resulting from MO3-poc1b
Phenotype Fish Figures
brain decreased size, abnormal AB + MO3-poc1b Fig. 4 from Zhang et al., 2015
cardiac ventricle dilated, abnormal AB + MO3-poc1b Fig. 4 from Zhang et al., 2015
eye decreased size, abnormal AB + MO3-poc1b Fig. 3,  Fig. 4 from Zhang et al., 2015
eye movement quality, abnormal AB + MO3-poc1b Fig. 3 from Zhang et al., 2015
head decreased size, abnormal AB + MO3-poc1b Fig. 4 from Zhang et al., 2015
heart morphology, abnormal AB + MO3-poc1b Fig. 3,  Fig. 4 from Zhang et al., 2015
heart contraction decreased rate, abnormal AB + MO3-poc1b text only from Zhang et al., 2015
Kupffer's vesicle motile cilium shortened, abnormal AB + MO3-poc1b Fig. 4 from Zhang et al., 2015
optokinetic behavior disrupted, abnormal AB + MO3-poc1b Fig. 3 from Zhang et al., 2015
photoreceptor outer segment layer disorganized, abnormal AB + MO3-poc1b Fig. 4 from Zhang et al., 2015
photoreceptor outer segment layer shortened, abnormal AB + MO3-poc1b Fig. 4 from Zhang et al., 2015
post-vent region curved, abnormal AB + MO3-poc1b Fig. 3 from Zhang et al., 2015
retina neuron disorganized, abnormal AB + MO3-poc1b Fig. 4 from Zhang et al., 2015
retina layer formation disrupted, abnormal AB + MO3-poc1b Fig. 4 from Zhang et al., 2015
whole organism decreased size, abnormal AB + MO3-poc1b Fig. 3 from Zhang et al., 2015
Phenotype of all Fish created by or utilizing MO3-poc1b
Phenotype Fish Conditions Figures
heart contraction decreased rate, abnormal AB + MO3-poc1b standard conditions text only from Zhang et al., 2015
heart morphology, abnormal AB + MO3-poc1b standard conditions Fig. 3,  Fig. 4 from Zhang et al., 2015
photoreceptor outer segment layer disorganized, abnormal AB + MO3-poc1b standard conditions Fig. 4 from Zhang et al., 2015
cardiac ventricle dilated, abnormal AB + MO3-poc1b standard conditions Fig. 4 from Zhang et al., 2015
retina layer formation disrupted, abnormal AB + MO3-poc1b standard conditions Fig. 4 from Zhang et al., 2015
optokinetic behavior disrupted, abnormal AB + MO3-poc1b standard conditions Fig. 3 from Zhang et al., 2015
head decreased size, abnormal AB + MO3-poc1b standard conditions Fig. 4 from Zhang et al., 2015
brain decreased size, abnormal AB + MO3-poc1b standard conditions Fig. 4 from Zhang et al., 2015
eye movement quality, abnormal AB + MO3-poc1b standard conditions Fig. 3 from Zhang et al., 2015
retina neuron disorganized, abnormal AB + MO3-poc1b standard conditions Fig. 4 from Zhang et al., 2015
photoreceptor outer segment layer shortened, abnormal AB + MO3-poc1b standard conditions Fig. 4 from Zhang et al., 2015
whole organism decreased size, abnormal AB + MO3-poc1b standard conditions Fig. 3 from Zhang et al., 2015
eye decreased size, abnormal AB + MO3-poc1b standard conditions Fig. 3,  Fig. 4 from Zhang et al., 2015
post-vent region curved, abnormal AB + MO3-poc1b standard conditions Fig. 3 from Zhang et al., 2015
Kupffer's vesicle motile cilium shortened, abnormal AB + MO3-poc1b standard conditions Fig. 4 from Zhang et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.